Question 1

Why don't transposable elements that move through replicative transposition eventually take over the genome completely?

Accepted Answer

Transposable elements (TEs) are DNA sequ...

Question 2

Give the inverted repeat of the following sequences:
a. 5'-ATCCGCT-3'
3'-TAGGCGA-5'
b. 5'-AAATTT-3'
3'-TTTAAA-5'
c. 5'-GGAATTCC-3'
3'-CCTTAAGG-5'

Accepted Answer

Inverted repeats in DNA sequences are se...

Question 3

Explain how bacterial resistance to antibiotics can be efficiently transmitted by transposons.

Accepted Answer

Transposons are genetic elements that ca...

Question 4

Which of the following pairs of sequences would you expect to be found in the same transposable element?

Accepted Answer

A)   inverted repeats and a gene for transposase
B)   long terminal repeats and a gene for transposase
C)   inverted repeats and a gene for reverse transcriptase
D)   a gene for transposase and a gene for reverse transcriptase
E)   both long terminal repeats and a gene for transposase and inverted repeats and a gene for reverse transcriptaseF) A) and E)
G) A) and B)

Question 5

Assume you are a geneticist and you're asked to examine the effects of a radiation leak that occurred at a facility in Iraq several years ago. How would you assess the level of mutations caused by this leak?

Accepted Answer

As a geneticist, I would first gather as...

Question 6

Which of the following DNA repair systems does NOT involve the activity of a DNA polymerase?

Accepted Answer

A)   mismatch repair in humans
B)   nucleotide-excision repair in yeast
C)   photoreactivation in E. coli
D)   base-excision repair in E. coli
E)   All of choices provided involve the activity of a DNA polymerase.F) A) and B)
G) B) and E)

Question 7

A new IS element is found in bacteria. Which of the following pairs of DNA sequences would MOST likely be found at each end of the IS element? (Only one of the two DNA strands is given.)

Accepted Answer

A)   5´-GAGACTCTAC-3´ and 5´-GAGACTCTAC-3´
B)   5´-GAGACTCTAC-3´ and 5´-CATCTCAGAG-3´
C)   5´-GAGACTCTAC-3´ and 5´-CTCTGAGATG-3´
D)   5´-GAGACTCTAC-3´ and 5´-GTAGAGTCTC-3´
E)   5´-GAGACTCTAC-3´ and 5´-CAGACTCTAG-3´F) B) and C)
G) C) and E)

Question 8

How do mutation rates differ among eukaryotic and prokaryotic organisms? What factors affect mutation rates?

Accepted Answer

Mutation rates can vary widely among euk...

Question 9

A transposable element is found to use RNA as an intermediate in transposition. On the basis of this information, which of the following would you expect to be CORRECT?

Accepted Answer

A)   The transposable element also probably makes transposase.
B)   The transposable element may encode a reverse transcriptase.
C)   The transposable element is probably located in a bacterial genome.
D)   The transposable element probably contains inverted repeats at each end.
E)   The transposable element will not be able to transpose without a second copy also present in the genome.F) B) and E)
G) B) and C)

Question 10

In the Ames test, what types of mutations are used to test for chemical mutagens?

Accepted Answer

A)   his- to his+ mutations
B)   pro- to pro+ mutations
C)   pro+ to pro- mutations
D)   his+ to his- mutations
E)   trp+ to trp- mutationsF) A) and D)
G) B) and C)

Question 11

Which of the following is a form of direct DNA repair?

Accepted Answer

A)   base-excision repair
B)   nucleotide-excision repair
C)   homologous recombination
D)   mismatch repair
E)   photoreactivationF) B) and D)
G) A) and E)

Question 12

A DNA sequence encodes a protein with the amino acid sequence Met-Leu-Ser-Ile-Met-Ala. A mutation occurs in the DNA sequence so that now it encodes a protein with the amino acid sequence Met-Leu-Val.
a. Propose an explanation for the type of mutation that produces the new amino acid sequence.
b. Give an example of a second mutation that would produce the following amino acid sequence: Met-Leu-Val-Ile-Met-Ala.

Accepted Answer

a. The type of mutation that produces th...

Question 13

Why do insertions and deletions often have more drastic phenotypic effects than do base substitutions?

Accepted Answer

Insertions and deletions (indels) often ...

Question 14

The mutation shown in the diagram below can BEST be described as a _____ mutation.

Accepted Answer

A)   missense
B)   nonsense
C)   silent
D)   neutral
E)   reverseF) B) and C)
G) B) and E)

Question 15

How do intergenic and intragenic suppressor mutations differ?

Accepted Answer

Intergenic and intragenic suppressor mut...

Question 16

Which of the following statements about somatic mutations is FALSE?

Accepted Answer

A)   Some may give rise to cancers in humans and other animals.
B)   They may be inherited by daughter cells after cell division.
C)   They may result in inactive gene products of the mutated genes.
D)   They may result from both frameshift and base-pair substitution mutations.
E)   They may be inherited in the offspring of mutated individuals.F) A) and B)
G) C) and D)

Question 17

What would be the result of a large deletion in the resolvase gene of a transposable element?

Accepted Answer

A large deletion in the resolvase gene o...

Question 18

Practically all transposable elements that have been studied are associated with which of the following?

Accepted Answer

A)   indirect repeats at each end
B)   a gene for transposase
C)   a gene for reverse transcriptase
D)   a gene for RNA polymerase
E)   flanking direct repeatsF) None of the above
G) B) and E)

Question 19

A diploid fungal cell is homozygous for a (TTG)5 trinucleotide repeat at a particular locus (see sequence below). During meiosis, an unequal crossover occurs at this locus between the second and third repeats on one homolog and between the third and fourth on the other. How many TTG repeats will each of the meiotic products have? (Assume that this species makes tetrads.)
ATGTTGTTGTTGTTGTTGTGA

Accepted Answer

To solve this problem, we need to unders...

Question 20

A codon that specifies the amino acid Ile undergoes a single-base substitution to become the amino acid Met. Which of the following describes the type of mutation that must have occurred?

Accepted Answer

A)   a transition mutation at the first position of the codon
B)   a transversion mutation at the first position of the codon
C)   a transition mutation at the third position of the codon
D)   a transversion mutation at the third position of the codon
E)   a transition mutation or a transversion mutation at the third position of the codonF) B) and D)
G) B) and E)

Exam 18: Gene Mutations and Dna Repair

In the Ames test, what types of mutations are used to test for chemical mutagens?

Correct Answer
verified

Which of the following pairs of sequences would you expect to be found in the same transposable element?

Correct Answer
verified

Why do insertions and deletions often have more drastic phenotypic effects than do base substitutions?

Correct Answer
Answered by ExamLex AI
Insertions and deletions (indels) often ...
View Answer

Give the inverted repeat of the following sequences: a. 5'-ATCCGCT-3' 3'-TAGGCGA-5' b. 5'-AAATTT-3' 3'-TTTAAA-5' c. 5'-GGAATTCC-3' 3'-CCTTAAGG-5'

Correct Answer
Answered by ExamLex AI
Inverted repeats in DNA sequences are se...
View Answer

Correct Answer
Answered by ExamLex AI
To solve this problem, we need to unders...
View Answer

How do mutation rates differ among eukaryotic and prokaryotic organisms? What factors affect mutation rates?

Correct Answer
Answered by ExamLex AI
Mutation rates can vary widely among euk...
View Answer

The mutation shown in the diagram below can BEST be described as a _____ mutation.

Correct Answer
verified

A new IS element is found in bacteria. Which of the following pairs of DNA sequences would MOST likely be found at each end of the IS element? (Only one of the two DNA strands is given.)

Correct Answer
verified

Assume you are a geneticist and you're asked to examine the effects of a radiation leak that occurred at a facility in Iraq several years ago. How would you assess the level of mutations caused by this leak?

Correct Answer
Answered by ExamLex AI
As a geneticist, I would first gather as...
View Answer

How do intergenic and intragenic suppressor mutations differ?

Correct Answer
Answered by ExamLex AI
Intergenic and intragenic suppressor mut...
View Answer

What would be the result of a large deletion in the resolvase gene of a transposable element?

Correct Answer
Answered by ExamLex AI
A large deletion in the resolvase gene o...
View Answer

A codon that specifies the amino acid Ile undergoes a single-base substitution to become the amino acid Met. Which of the following describes the type of mutation that must have occurred?

Correct Answer
verified

Which of the following DNA repair systems does NOT involve the activity of a DNA polymerase?

Correct Answer
verified

Correct Answer
Answered by ExamLex AI
a. The type of mutation that produces th...
View Answer

Which of the following statements about somatic mutations is FALSE?

Correct Answer
verified

Explain how bacterial resistance to antibiotics can be efficiently transmitted by transposons.

Correct Answer
Answered by ExamLex AI
Transposons are genetic elements that ca...
View Answer

Practically all transposable elements that have been studied are associated with which of the following?

Correct Answer
verified

Why don't transposable elements that move through replicative transposition eventually take over the genome completely?

Correct Answer
Answered by ExamLex AI
Transposable elements (TEs) are DNA sequ...
View Answer

A transposable element is found to use RNA as an intermediate in transposition. On the basis of this information, which of the following would you expect to be CORRECT?

Correct Answer
verified

Which of the following is a form of direct DNA repair?

Correct Answer
verified

Exam 18: Gene Mutations and Dna Repair

In the Ames test, what types of mutations are used to test for chemical mutagens?

Correct AnswerverifiedShow Answer

Which of the following pairs of sequences would you expect to be found in the same transposable element?

Correct AnswerverifiedShow Answer

Why do insertions and deletions often have more drastic phenotypic effects than do base substitutions?

Correct AnswerAnswered by ExamLex AIInsertions and deletions (indels) often ...View AnswerShow Answer

Give the inverted repeat of the following sequences: a. 5'-ATCCGCT-3' 3'-TAGGCGA-5' b. 5'-AAATTT-3' 3'-TTTAAA-5' c. 5'-GGAATTCC-3' 3'-CCTTAAGG-5'

Correct AnswerAnswered by ExamLex AIInverted repeats in DNA sequences are se...View AnswerShow Answer

Correct AnswerAnswered by ExamLex AITo solve this problem, we need to unders...View AnswerShow Answer

How do mutation rates differ among eukaryotic and prokaryotic organisms? What factors affect mutation rates?

Correct AnswerAnswered by ExamLex AIMutation rates can vary widely among euk...View AnswerShow Answer

The mutation shown in the diagram below can BEST be described as a _____ mutation.

Correct AnswerverifiedShow Answer

A new IS element is found in bacteria. Which of the following pairs of DNA sequences would MOST likely be found at each end of the IS element? (Only one of the two DNA strands is given.)

Correct AnswerverifiedShow Answer

Assume you are a geneticist and you're asked to examine the effects of a radiation leak that occurred at a facility in Iraq several years ago. How would you assess the level of mutations caused by this leak?

Correct AnswerAnswered by ExamLex AIAs a geneticist, I would first gather as...View AnswerShow Answer

How do intergenic and intragenic suppressor mutations differ?

Correct AnswerAnswered by ExamLex AIIntergenic and intragenic suppressor mut...View AnswerShow Answer

What would be the result of a large deletion in the resolvase gene of a transposable element?

Correct AnswerAnswered by ExamLex AIA large deletion in the resolvase gene o...View AnswerShow Answer

A codon that specifies the amino acid Ile undergoes a single-base substitution to become the amino acid Met. Which of the following describes the type of mutation that must have occurred?

Correct AnswerverifiedShow Answer

Which of the following DNA repair systems does NOT involve the activity of a DNA polymerase?

Correct AnswerverifiedShow Answer

Correct AnswerAnswered by ExamLex AIa. The type of mutation that produces th...View AnswerShow Answer

Which of the following statements about somatic mutations is FALSE?

Correct AnswerverifiedShow Answer

Explain how bacterial resistance to antibiotics can be efficiently transmitted by transposons.

Correct AnswerAnswered by ExamLex AITransposons are genetic elements that ca...View AnswerShow Answer

Practically all transposable elements that have been studied are associated with which of the following?

Correct AnswerverifiedShow Answer

Why don't transposable elements that move through replicative transposition eventually take over the genome completely?

Correct AnswerAnswered by ExamLex AITransposable elements (TEs) are DNA sequ...View AnswerShow Answer

A transposable element is found to use RNA as an intermediate in transposition. On the basis of this information, which of the following would you expect to be CORRECT?

Correct AnswerverifiedShow Answer

Which of the following is a form of direct DNA repair?

Correct AnswerverifiedShow Answer

Correct Answer
verified

Correct Answer
verified

Correct Answer
Answered by ExamLex AI
Insertions and deletions (indels) often ...
View Answer

Correct Answer
Answered by ExamLex AI
Inverted repeats in DNA sequences are se...
View Answer

Correct Answer
Answered by ExamLex AI
To solve this problem, we need to unders...
View Answer

Correct Answer
Answered by ExamLex AI
Mutation rates can vary widely among euk...
View Answer

Correct Answer
verified

Correct Answer
verified

Correct Answer
Answered by ExamLex AI
As a geneticist, I would first gather as...
View Answer

Correct Answer
Answered by ExamLex AI
Intergenic and intragenic suppressor mut...
View Answer

Correct Answer
Answered by ExamLex AI
A large deletion in the resolvase gene o...
View Answer

Correct Answer
verified

Correct Answer
verified

Correct Answer
Answered by ExamLex AI
a. The type of mutation that produces th...
View Answer

Correct Answer
verified

Correct Answer
Answered by ExamLex AI
Transposons are genetic elements that ca...
View Answer

Correct Answer
verified

Correct Answer
Answered by ExamLex AI
Transposable elements (TEs) are DNA sequ...
View Answer

Correct Answer
verified

Correct Answer
verified