Filters
Question type

Study Flashcards

A polypeptide has the following amino acid sequence: Met-Ala-Gln-Arg-Glu-Leu. This polypeptide was mutated to produce the following mutant sequence: Met-Ala-Gln-Gly-Glu-Leu. Which describes the MOST likely type of mutation that occurred?


A) nonsense mutation
B) missense mutation
C) frameshift mutation
D) in-frame mutation
E) neutral mutation

F) B) and E)
G) All of the above

Correct Answer

verifed

verified

Ultraviolet light causes what type of DNA lesion?


A) large deletions
B) deaminated cytosines
C) pyrimidine dimers
D) mismatched bases
E) depurinations

F) A) and B)
G) A) and E)

Correct Answer

verifed

verified

A scientist discovers a mutant gene in which a nucleotide was deleted. Which of the following chemicals could potentially reverse this mutation?


A) ethidium bromide
B) hydroxylamine
C) 5-bromouracil
D) EMS
E) nitrous acid

F) A) and B)
G) None of the above

Correct Answer

verifed

verified

Which of the following statements describes the possible parasitic nature of transposable elements?


A) Transposable elements can increase in number within genomes without providing an advantage to the host.
B) Transposable elements are collected within their genomes by host organisms so that the host will benefit but not the transposable elements.
C) Transposable elements will provide an evolutionary advantage to host organisms by transposing as often as possible.
D) Transposable elements will enhance their expression of transposase so that the hosts can evolve more quickly.
E) Transposable elements will add methyl groups to their own DNA to reduce their own rate of transposition.

F) B) and D)
G) A) and B)

Correct Answer

verifed

verified

A

Which of the following pairs of DNA repair systems will repair pyrimidine dimers in E. coli?


A) mismatch repair and base-excision repair
B) photoreactivation and mismatch repair
C) nucleotide-excision repair and base-excision repair
D) photoreactivation and nucleotide-excision repair
E) nonhomologous end joining and nucleotide-excision repair

F) B) and D)
G) A) and D)

Correct Answer

verifed

verified

D

A company has invented a new low-calorie sugar substitute and wants to determine if the substitute might be carcinogenic, so researchers use it in the Ames test. The results show no increase in mutant bacterial colonies. They then perform feeding experiments in laboratory rats and find a significant increase in the incidence of cancer. Offer an explanation for why the Ames test did not accurately predict the carcinogenic potential of the sugar substitute and suggest a solution to the problem.

Correct Answer

Answered by ExamLex AI

Answered by ExamLex AI

The discrepancy between the results of t...

View Answer

Most transposable elements are flanked by direct DNA repeats. What is the significance of these direct repeats?

Correct Answer

Answered by ExamLex AI

Answered by ExamLex AI

The direct DNA repeats flanking most tra...

View Answer

The following sequence represents the DNA template strand of a gene: The following sequence represents the DNA template strand of a gene:   a. Give the sequence of the mRNA transcribed from this DNA strand and, using the genetic code provided in Figure 15.12, give the amino acid sequence of the protein it encodes.  b. Give the amino acid sequence of the protein encoded by this sequence after the following mutations have occurred: - a transition at nucleotide #10 - a transition at nucleotide #12 - atransition at nucleotide #7 - an insertion of a  G  immediately following nucleotide #10 a. Give the sequence of the mRNA transcribed from this DNA strand and, using the genetic code provided in Figure 15.12, give the amino acid sequence of the protein it encodes. b. Give the amino acid sequence of the protein encoded by this sequence after the following mutations have occurred: - a transition at nucleotide #10 - a transition at nucleotide #12 - atransition at nucleotide #7 - an insertion of a "G" immediately following nucleotide #10

Correct Answer

verifed

verified

Which of the following transposable elements are flanked by direct repeats of a short portion of the host genome?


A) Tn10
B) L1
C) Activator (Ac)
D) Alu
E) All of the answers are correct.

F) A) and D)
G) B) and D)

Correct Answer

verifed

verified

A geneticist is studying a mutation in a population of turtles that causes their shells to become extremely brittle. She determines the mutation is caused by the loss of two nucleotides in the coding region of a gene. Upon studying the mutant protein that is produced, she observes that it is 312 amino acids in length, as compared to the normal protein that is 588 amino acids in length. This mutant protein can no longer carry out its normal function of assisting in the Difficultening of a turtle's shell. Which of the following could NOT describe this mutation?


A) deletion
B) loss-of-function mutation
C) transversion
D) frameshift mutation
E) nonsense mutation

F) A) and E)
G) None of the above

Correct Answer

verifed

verified

Hybrid dysgenesis in Drosophila occurs:


A) when a male and a female, each carrying a copia element, mate and produce offspring that have numerous mutations.
B) in the offspring of a cross between a male that carries a copia element and a female that carries a P element.
C) in the offspring of a cross between a male that carries a Ty element and a female that carries an Ac element.
D) in the offspring of a cross between a male that carries a P element and a female that does not carry a P element.
E) in the offspring of a cross between a male that carries an Alu element and a female that carries a Ty element.

F) A) and B)
G) A) and C)

Correct Answer

verifed

verified

A single base substitution caused the amino acid sequence Met-His-Glu-Cys to be changed to Met-His. Which of the following describes the type of mutation that caused this change?


A) transition mutation
B) transversion mutation
C) translesion mutation
D) nucleotide deletion
E) strand slippage

F) C) and D)
G) A) and D)

Correct Answer

verifed

verified

Explain how transposable elements might play a role in studying gene function.

Correct Answer

Answered by ExamLex AI

Answered by ExamLex AI

Transposable elements, also known as tra...

View Answer

Why do disruptive DNA lesions, like deletions and insertions, sometimes not lead to frameshift mutations?

Correct Answer

Answered by ExamLex AI

Answered by ExamLex AI

Disruptive DNA lesions such as deletions...

View Answer

You are working on an insulin-binding protein from fish. The beginning of the coding sequence of the gene is shown below. You find a mutant in the gene that cannot bind insulin (also shown below-the mutation is set in boldface type). Among a population of fish having the gene for the mutant protein, you find one that produces a variant of this protein that can now bind insulin again (DNA sequence also shown below). What kind of mutation is this new variant? (Use a genetic rather than a biochemical classification.) Original sequence: atgtgtcctatgtgagttgcggcttgttg Mutant sequence: atg g tgtcctatgtgagttgcggctgttg Variant sequence: atg g tgtcctatgtgagttgcggcttg g tg

Correct Answer

Answered by ExamLex AI

Answered by ExamLex AI

The original sequence provided is:

atgt...

View Answer

A codon for the amino acid serine undergoes a transversion so that it now codes for threonine. A transversion at a different site in the same codon then suppresses the first mutation. Give the nucleotides in the original codon, the transition mutation, and the transversion suppressor. (Note: There are two possible answers.)

Correct Answer

Answered by ExamLex AI

Answered by ExamLex AI

Serine is coded by several codons: UCU, ...

View Answer

Which of the following types of mutations does NOT lead to a change in the amino acid sequence of the gene product?


A) missense mutation
B) nonsense mutation
C) neutral mutation
D) silent mutation
E) loss-of-function mutation

F) A) and B)
G) A) and E)

Correct Answer

verifed

verified

What do alkylating agents do?


A) They cause pyrimidine dimers.
B) They add methyl or ethyl groups to bases.
C) They oxidize guanine.
D) They deaminate cytosine.
E) All of the answers are correct.

F) A) and B)
G) A) and C)

Correct Answer

verifed

verified

Upon transposing to a new site, transposable elements:


A) add methyl groups to bases of the surrounding DNA.
B) delete about 100 base pairs of DNA on each side of them.
C) duplicate their transposase gene.
D) express a gene that confers sensitivity to some common antibiotics.
E) create a duplication of a target sequence on each side of them.

F) A) and B)
G) C) and E)

Correct Answer

verifed

verified

Suppose that you identify a mutation in a gene caused by a single base substitution. Which of the following would be the BEST choice to use in an attempt to reverse this mutation?


A) UV light
B) ethidium bromide
C) hydroxylamine
D) acridine orange
E) EMS

F) A) and E)
G) A) and D)

Correct Answer

verifed

verified

E

Showing 1 - 20 of 100

Related Exams

Show Answer